t7-scribe standard rna ivt kit (cellscript, c-as3107) (Cellscript Inc)
90
Structured Review
Cellscript Inc
t7-scribe standard rna ivt kit (cellscript, c-as3107)
T7 Scribe Standard Rna Ivt Kit (Cellscript, C As3107), supplied by Cellscript Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/t7-scribe+standard+rna+ivt+kit+(cellscript%2C+c-as3107)/t7+scribetm+standard+rna+ivt+kit+c+as3107/us12297484-949-68-73
Average 90 stars, based on 1 article reviews
T7 Scribe Standard Rna Ivt Kit (Cellscript, C As3107), supplied by Cellscript Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/t7-scribe+standard+rna+ivt+kit+(cellscript%2C+c-as3107)/t7+scribetm+standard+rna+ivt+kit+c+as3107/us12297484-949-68-73
Average 90 stars, based on 1 article reviews
t7-scribe standard rna ivt kit (cellscript, c-as3107) - by Bioz Stars,
2026-09
90/100 stars
Images
Related Articles
Hybridization:Article Title: Methods, compositions, and kits for preparing nucleic acid libraries Article Snippet: Materials Target polynucleotide, human gDNA (BIO-35025) DNA fragmenting enzyme, KAPA Frag Kit (Roche, 7962517001) Adaptor template oligos (ATO), 1-019, 1-020 (Table 1) TAQ DNA polymerase (NEB, M0273L) TAQ DNA polymerase buffer (NEB, M0273L) DNA Polymerase I, Large (Klenow) Fragment (NEB, M0210L, M0212L) dNTPs (NEB, N0447s) USER® Enzyme (NEB, M5505S) Agencourt AMPure XP (Beckman Coulter, A63881) Article Title: Human-rabbit Hybrid Translation System to Explore the Function of Modified Ribosomes Article Snippet: Article Title: A specific eIF4A paralog facilitates LARP1-mediated translation repression during mTORC1 inhibition Article Snippet: Two guide RNAs were transcribed from the template PCR fragments (5′- TAATACGACTCACTATAGG GTGGCTCCGCGGATTATAAC GTTTAAGAGCTAT GCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGA AAAAGTGGCACCGAGTCGGTGCTTTTTTT-3′ and 5′- TAATACGACTCACTATAGG CCAGAGGGAATGGACCCCGA GTTTAAGAGCTA TGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTG AAAAAGTGGCACCGAGTCGGTGCTTTTTTT-3′, where the underlined characters represent sequences complementary to the EIF4A2 gene locus) by a Article Title: Sequence grammar and dynamics of subcellular translation revealed by APEX-Ribo-Seq Article Snippet: After hybridization of complementary DNA to the T7 promoter sequence, RNAs were amplified by in vitro transcription using the Article Title: Methods, compositions, and kits for preparing nucleic acid libraries Article Snippet: Materials Target polynucleotide, human gDNA (BIO-35025) DNA fragmenting enzyme, KAPA Frag Kit (Roche, 7962517001) Adaptor template oligos (ATO), 1-021 (Table 1) TAQ DNA polymerase (NEB, M0273L) TAQ DNA polymerase buffer (NEB, M0273L) DNA Polymerase I, Large (Klenow) Fragment (NEB, M0210L, M0212L) dNTPs (NEB, N0447s) Phusion® High-Fidelity DNA Polymerase (NEB, M0530S) Phusion buffer (NEB, M0530S) USER® Enzyme (NEB, M5505S) S1 Nuclease (ThermoFisher, EN0321) Agencourt AMPure XP (Beckman Coulter, A63881) Article Title: RS-1 enhances CRISPR/Cas9- and TALEN-mediated knock-in efficiency Article Snippet: TALEN, Cas9 and RAD51 mRNAs were transcribed in vitro , caped and polyadenylated using the Article Title: Host targeted inhibitors of dengue virus and other viruses Article Snippet: In vitro transcripts were synthesized from PstI linearized pDENrep-FH using Sequencing:Article Title: Methods, compositions, and kits for preparing nucleic acid libraries Article Snippet: Materials Target polynucleotide, human gDNA (BIO-35025) DNA fragmenting enzyme, KAPA Frag Kit (Roche, 7962517001) Adaptor template oligos (ATO), 1-019, 1-020 (Table 1) TAQ DNA polymerase (NEB, M0273L) TAQ DNA polymerase buffer (NEB, M0273L) DNA Polymerase I, Large (Klenow) Fragment (NEB, M0210L, M0212L) dNTPs (NEB, N0447s) USER® Enzyme (NEB, M5505S) Agencourt AMPure XP (Beckman Coulter, A63881) Article Title: Human-rabbit Hybrid Translation System to Explore the Function of Modified Ribosomes Article Snippet: Article Title: A specific eIF4A paralog facilitates LARP1-mediated translation repression during mTORC1 inhibition Article Snippet: Two guide RNAs were transcribed from the template PCR fragments (5′- TAATACGACTCACTATAGG GTGGCTCCGCGGATTATAAC GTTTAAGAGCTAT GCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGA AAAAGTGGCACCGAGTCGGTGCTTTTTTT-3′ and 5′- TAATACGACTCACTATAGG CCAGAGGGAATGGACCCCGA GTTTAAGAGCTA TGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTG AAAAAGTGGCACCGAGTCGGTGCTTTTTTT-3′, where the underlined characters represent sequences complementary to the EIF4A2 gene locus) by a Article Title: Sequence grammar and dynamics of subcellular translation revealed by APEX-Ribo-Seq Article Snippet: After hybridization of complementary DNA to the T7 promoter sequence, RNAs were amplified by in vitro transcription using the Article Title: Methods, compositions, and kits for preparing nucleic acid libraries Article Snippet: Materials Target polynucleotide, human gDNA (BIO-35025) DNA fragmenting enzyme, KAPA Frag Kit (Roche, 7962517001) Adaptor template oligos (ATO), 1-021 (Table 1) TAQ DNA polymerase (NEB, M0273L) TAQ DNA polymerase buffer (NEB, M0273L) DNA Polymerase I, Large (Klenow) Fragment (NEB, M0210L, M0212L) dNTPs (NEB, N0447s) Phusion® High-Fidelity DNA Polymerase (NEB, M0530S) Phusion buffer (NEB, M0530S) USER® Enzyme (NEB, M5505S) S1 Nuclease (ThermoFisher, EN0321) Agencourt AMPure XP (Beckman Coulter, A63881) Article Title: RS-1 enhances CRISPR/Cas9- and TALEN-mediated knock-in efficiency Article Snippet: TALEN, Cas9 and RAD51 mRNAs were transcribed in vitro , caped and polyadenylated using the Article Title: Host targeted inhibitors of dengue virus and other viruses Article Snippet: In vitro transcripts were synthesized from PstI linearized pDENrep-FH using Amplification:Article Title: Methods, compositions, and kits for preparing nucleic acid libraries Article Snippet: Materials Target polynucleotide, human gDNA (BIO-35025) DNA fragmenting enzyme, KAPA Frag Kit (Roche, 7962517001) Adaptor template oligos (ATO), 1-019, 1-020 (Table 1) TAQ DNA polymerase (NEB, M0273L) TAQ DNA polymerase buffer (NEB, M0273L) DNA Polymerase I, Large (Klenow) Fragment (NEB, M0210L, M0212L) dNTPs (NEB, N0447s) USER® Enzyme (NEB, M5505S) Agencourt AMPure XP (Beckman Coulter, A63881) Article Title: Human-rabbit Hybrid Translation System to Explore the Function of Modified Ribosomes Article Snippet: Article Title: A specific eIF4A paralog facilitates LARP1-mediated translation repression during mTORC1 inhibition Article Snippet: Two guide RNAs were transcribed from the template PCR fragments (5′- TAATACGACTCACTATAGG GTGGCTCCGCGGATTATAAC GTTTAAGAGCTAT GCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGA AAAAGTGGCACCGAGTCGGTGCTTTTTTT-3′ and 5′- TAATACGACTCACTATAGG CCAGAGGGAATGGACCCCGA GTTTAAGAGCTA TGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTG AAAAAGTGGCACCGAGTCGGTGCTTTTTTT-3′, where the underlined characters represent sequences complementary to the EIF4A2 gene locus) by a Article Title: Sequence grammar and dynamics of subcellular translation revealed by APEX-Ribo-Seq Article Snippet: After hybridization of complementary DNA to the T7 promoter sequence, RNAs were amplified by in vitro transcription using the Article Title: Methods, compositions, and kits for preparing nucleic acid libraries Article Snippet: Materials Target polynucleotide, human gDNA (BIO-35025) DNA fragmenting enzyme, KAPA Frag Kit (Roche, 7962517001) Adaptor template oligos (ATO), 1-021 (Table 1) TAQ DNA polymerase (NEB, M0273L) TAQ DNA polymerase buffer (NEB, M0273L) DNA Polymerase I, Large (Klenow) Fragment (NEB, M0210L, M0212L) dNTPs (NEB, N0447s) Phusion® High-Fidelity DNA Polymerase (NEB, M0530S) Phusion buffer (NEB, M0530S) USER® Enzyme (NEB, M5505S) S1 Nuclease (ThermoFisher, EN0321) Agencourt AMPure XP (Beckman Coulter, A63881) Article Title: RS-1 enhances CRISPR/Cas9- and TALEN-mediated knock-in efficiency Article Snippet: TALEN, Cas9 and RAD51 mRNAs were transcribed in vitro , caped and polyadenylated using the Article Title: Host targeted inhibitors of dengue virus and other viruses Article Snippet: In vitro transcripts were synthesized from PstI linearized pDENrep-FH using In Vitro:Article Title: Methods, compositions, and kits for preparing nucleic acid libraries Article Snippet: Materials Target polynucleotide, human gDNA (BIO-35025) DNA fragmenting enzyme, KAPA Frag Kit (Roche, 7962517001) Adaptor template oligos (ATO), 1-019, 1-020 (Table 1) TAQ DNA polymerase (NEB, M0273L) TAQ DNA polymerase buffer (NEB, M0273L) DNA Polymerase I, Large (Klenow) Fragment (NEB, M0210L, M0212L) dNTPs (NEB, N0447s) USER® Enzyme (NEB, M5505S) Agencourt AMPure XP (Beckman Coulter, A63881) Article Title: Human-rabbit Hybrid Translation System to Explore the Function of Modified Ribosomes Article Snippet: Article Title: A specific eIF4A paralog facilitates LARP1-mediated translation repression during mTORC1 inhibition Article Snippet: Two guide RNAs were transcribed from the template PCR fragments (5′- TAATACGACTCACTATAGG GTGGCTCCGCGGATTATAAC GTTTAAGAGCTAT GCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGA AAAAGTGGCACCGAGTCGGTGCTTTTTTT-3′ and 5′- TAATACGACTCACTATAGG CCAGAGGGAATGGACCCCGA GTTTAAGAGCTA TGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTG AAAAAGTGGCACCGAGTCGGTGCTTTTTTT-3′, where the underlined characters represent sequences complementary to the EIF4A2 gene locus) by a Article Title: Sequence grammar and dynamics of subcellular translation revealed by APEX-Ribo-Seq Article Snippet: After hybridization of complementary DNA to the T7 promoter sequence, RNAs were amplified by in vitro transcription using the Article Title: Methods, compositions, and kits for preparing nucleic acid libraries Article Snippet: Materials Target polynucleotide, human gDNA (BIO-35025) DNA fragmenting enzyme, KAPA Frag Kit (Roche, 7962517001) Adaptor template oligos (ATO), 1-021 (Table 1) TAQ DNA polymerase (NEB, M0273L) TAQ DNA polymerase buffer (NEB, M0273L) DNA Polymerase I, Large (Klenow) Fragment (NEB, M0210L, M0212L) dNTPs (NEB, N0447s) Phusion® High-Fidelity DNA Polymerase (NEB, M0530S) Phusion buffer (NEB, M0530S) USER® Enzyme (NEB, M5505S) S1 Nuclease (ThermoFisher, EN0321) Agencourt AMPure XP (Beckman Coulter, A63881) Article Title: RS-1 enhances CRISPR/Cas9- and TALEN-mediated knock-in efficiency Article Snippet: TALEN, Cas9 and RAD51 mRNAs were transcribed in vitro , caped and polyadenylated using the Article Title: Host targeted inhibitors of dengue virus and other viruses Article Snippet: In vitro transcripts were synthesized from PstI linearized pDENrep-FH using Produced:Article Title: Methods, compositions, and kits for preparing nucleic acid libraries Article Snippet: Materials Target polynucleotide, human gDNA (BIO-35025) DNA fragmenting enzyme, KAPA Frag Kit (Roche, 7962517001) Adaptor template oligos (ATO), 1-019, 1-020 (Table 1) TAQ DNA polymerase (NEB, M0273L) TAQ DNA polymerase buffer (NEB, M0273L) DNA Polymerase I, Large (Klenow) Fragment (NEB, M0210L, M0212L) dNTPs (NEB, N0447s) USER® Enzyme (NEB, M5505S) Agencourt AMPure XP (Beckman Coulter, A63881) Article Title: Human-rabbit Hybrid Translation System to Explore the Function of Modified Ribosomes Article Snippet: Article Title: A specific eIF4A paralog facilitates LARP1-mediated translation repression during mTORC1 inhibition Article Snippet: Two guide RNAs were transcribed from the template PCR fragments (5′- TAATACGACTCACTATAGG GTGGCTCCGCGGATTATAAC GTTTAAGAGCTAT GCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGA AAAAGTGGCACCGAGTCGGTGCTTTTTTT-3′ and 5′- TAATACGACTCACTATAGG CCAGAGGGAATGGACCCCGA GTTTAAGAGCTA TGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTG AAAAAGTGGCACCGAGTCGGTGCTTTTTTT-3′, where the underlined characters represent sequences complementary to the EIF4A2 gene locus) by a Article Title: Sequence grammar and dynamics of subcellular translation revealed by APEX-Ribo-Seq Article Snippet: After hybridization of complementary DNA to the T7 promoter sequence, RNAs were amplified by in vitro transcription using the Article Title: Methods, compositions, and kits for preparing nucleic acid libraries Article Snippet: Materials Target polynucleotide, human gDNA (BIO-35025) DNA fragmenting enzyme, KAPA Frag Kit (Roche, 7962517001) Adaptor template oligos (ATO), 1-021 (Table 1) TAQ DNA polymerase (NEB, M0273L) TAQ DNA polymerase buffer (NEB, M0273L) DNA Polymerase I, Large (Klenow) Fragment (NEB, M0210L, M0212L) dNTPs (NEB, N0447s) Phusion® High-Fidelity DNA Polymerase (NEB, M0530S) Phusion buffer (NEB, M0530S) USER® Enzyme (NEB, M5505S) S1 Nuclease (ThermoFisher, EN0321) Agencourt AMPure XP (Beckman Coulter, A63881) Article Title: RS-1 enhances CRISPR/Cas9- and TALEN-mediated knock-in efficiency Article Snippet: TALEN, Cas9 and RAD51 mRNAs were transcribed in vitro , caped and polyadenylated using the Article Title: Host targeted inhibitors of dengue virus and other viruses Article Snippet: In vitro transcripts were synthesized from PstI linearized pDENrep-FH using Derivative Assay:Article Title: Methods, compositions, and kits for preparing nucleic acid libraries Article Snippet: Materials Target polynucleotide, human gDNA (BIO-35025) DNA fragmenting enzyme, KAPA Frag Kit (Roche, 7962517001) Adaptor template oligos (ATO), 1-019, 1-020 (Table 1) TAQ DNA polymerase (NEB, M0273L) TAQ DNA polymerase buffer (NEB, M0273L) DNA Polymerase I, Large (Klenow) Fragment (NEB, M0210L, M0212L) dNTPs (NEB, N0447s) USER® Enzyme (NEB, M5505S) Agencourt AMPure XP (Beckman Coulter, A63881) Article Title: Human-rabbit Hybrid Translation System to Explore the Function of Modified Ribosomes Article Snippet: Article Title: A specific eIF4A paralog facilitates LARP1-mediated translation repression during mTORC1 inhibition Article Snippet: Two guide RNAs were transcribed from the template PCR fragments (5′- TAATACGACTCACTATAGG GTGGCTCCGCGGATTATAAC GTTTAAGAGCTAT GCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGA AAAAGTGGCACCGAGTCGGTGCTTTTTTT-3′ and 5′- TAATACGACTCACTATAGG CCAGAGGGAATGGACCCCGA GTTTAAGAGCTA TGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTG AAAAAGTGGCACCGAGTCGGTGCTTTTTTT-3′, where the underlined characters represent sequences complementary to the EIF4A2 gene locus) by a Article Title: Sequence grammar and dynamics of subcellular translation revealed by APEX-Ribo-Seq Article Snippet: After hybridization of complementary DNA to the T7 promoter sequence, RNAs were amplified by in vitro transcription using the Article Title: Methods, compositions, and kits for preparing nucleic acid libraries Article Snippet: Materials Target polynucleotide, human gDNA (BIO-35025) DNA fragmenting enzyme, KAPA Frag Kit (Roche, 7962517001) Adaptor template oligos (ATO), 1-021 (Table 1) TAQ DNA polymerase (NEB, M0273L) TAQ DNA polymerase buffer (NEB, M0273L) DNA Polymerase I, Large (Klenow) Fragment (NEB, M0210L, M0212L) dNTPs (NEB, N0447s) Phusion® High-Fidelity DNA Polymerase (NEB, M0530S) Phusion buffer (NEB, M0530S) USER® Enzyme (NEB, M5505S) S1 Nuclease (ThermoFisher, EN0321) Agencourt AMPure XP (Beckman Coulter, A63881) Article Title: RS-1 enhances CRISPR/Cas9- and TALEN-mediated knock-in efficiency Article Snippet: TALEN, Cas9 and RAD51 mRNAs were transcribed in vitro , caped and polyadenylated using the Article Title: Host targeted inhibitors of dengue virus and other viruses Article Snippet: In vitro transcripts were synthesized from PstI linearized pDENrep-FH using Polymerase Chain Reaction:Article Title: Methods, compositions, and kits for preparing nucleic acid libraries Article Snippet: Materials Target polynucleotide, human gDNA (BIO-35025) DNA fragmenting enzyme, KAPA Frag Kit (Roche, 7962517001) Adaptor template oligos (ATO), 1-019, 1-020 (Table 1) TAQ DNA polymerase (NEB, M0273L) TAQ DNA polymerase buffer (NEB, M0273L) DNA Polymerase I, Large (Klenow) Fragment (NEB, M0210L, M0212L) dNTPs (NEB, N0447s) USER® Enzyme (NEB, M5505S) Agencourt AMPure XP (Beckman Coulter, A63881) Article Title: Human-rabbit Hybrid Translation System to Explore the Function of Modified Ribosomes Article Snippet: Article Title: A specific eIF4A paralog facilitates LARP1-mediated translation repression during mTORC1 inhibition Article Snippet: Two guide RNAs were transcribed from the template PCR fragments (5′- TAATACGACTCACTATAGG GTGGCTCCGCGGATTATAAC GTTTAAGAGCTAT GCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGA AAAAGTGGCACCGAGTCGGTGCTTTTTTT-3′ and 5′- TAATACGACTCACTATAGG CCAGAGGGAATGGACCCCGA GTTTAAGAGCTA TGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTG AAAAAGTGGCACCGAGTCGGTGCTTTTTTT-3′, where the underlined characters represent sequences complementary to the EIF4A2 gene locus) by a Article Title: Sequence grammar and dynamics of subcellular translation revealed by APEX-Ribo-Seq Article Snippet: After hybridization of complementary DNA to the T7 promoter sequence, RNAs were amplified by in vitro transcription using the Article Title: Methods, compositions, and kits for preparing nucleic acid libraries Article Snippet: Materials Target polynucleotide, human gDNA (BIO-35025) DNA fragmenting enzyme, KAPA Frag Kit (Roche, 7962517001) Adaptor template oligos (ATO), 1-021 (Table 1) TAQ DNA polymerase (NEB, M0273L) TAQ DNA polymerase buffer (NEB, M0273L) DNA Polymerase I, Large (Klenow) Fragment (NEB, M0210L, M0212L) dNTPs (NEB, N0447s) Phusion® High-Fidelity DNA Polymerase (NEB, M0530S) Phusion buffer (NEB, M0530S) USER® Enzyme (NEB, M5505S) S1 Nuclease (ThermoFisher, EN0321) Agencourt AMPure XP (Beckman Coulter, A63881) Article Title: RS-1 enhances CRISPR/Cas9- and TALEN-mediated knock-in efficiency Article Snippet: TALEN, Cas9 and RAD51 mRNAs were transcribed in vitro , caped and polyadenylated using the Article Title: Host targeted inhibitors of dengue virus and other viruses Article Snippet: In vitro transcripts were synthesized from PstI linearized pDENrep-FH using Reporter Assay:Article Title: Methods, compositions, and kits for preparing nucleic acid libraries Article Snippet: Materials Target polynucleotide, human gDNA (BIO-35025) DNA fragmenting enzyme, KAPA Frag Kit (Roche, 7962517001) Adaptor template oligos (ATO), 1-019, 1-020 (Table 1) TAQ DNA polymerase (NEB, M0273L) TAQ DNA polymerase buffer (NEB, M0273L) DNA Polymerase I, Large (Klenow) Fragment (NEB, M0210L, M0212L) dNTPs (NEB, N0447s) USER® Enzyme (NEB, M5505S) Agencourt AMPure XP (Beckman Coulter, A63881) Article Title: Human-rabbit Hybrid Translation System to Explore the Function of Modified Ribosomes Article Snippet: Article Title: A specific eIF4A paralog facilitates LARP1-mediated translation repression during mTORC1 inhibition Article Snippet: Two guide RNAs were transcribed from the template PCR fragments (5′- TAATACGACTCACTATAGG GTGGCTCCGCGGATTATAAC GTTTAAGAGCTAT GCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGA AAAAGTGGCACCGAGTCGGTGCTTTTTTT-3′ and 5′- TAATACGACTCACTATAGG CCAGAGGGAATGGACCCCGA GTTTAAGAGCTA TGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTG AAAAAGTGGCACCGAGTCGGTGCTTTTTTT-3′, where the underlined characters represent sequences complementary to the EIF4A2 gene locus) by a Article Title: Sequence grammar and dynamics of subcellular translation revealed by APEX-Ribo-Seq Article Snippet: After hybridization of complementary DNA to the T7 promoter sequence, RNAs were amplified by in vitro transcription using the Article Title: Methods, compositions, and kits for preparing nucleic acid libraries Article Snippet: Materials Target polynucleotide, human gDNA (BIO-35025) DNA fragmenting enzyme, KAPA Frag Kit (Roche, 7962517001) Adaptor template oligos (ATO), 1-021 (Table 1) TAQ DNA polymerase (NEB, M0273L) TAQ DNA polymerase buffer (NEB, M0273L) DNA Polymerase I, Large (Klenow) Fragment (NEB, M0210L, M0212L) dNTPs (NEB, N0447s) Phusion® High-Fidelity DNA Polymerase (NEB, M0530S) Phusion buffer (NEB, M0530S) USER® Enzyme (NEB, M5505S) S1 Nuclease (ThermoFisher, EN0321) Agencourt AMPure XP (Beckman Coulter, A63881) Article Title: RS-1 enhances CRISPR/Cas9- and TALEN-mediated knock-in efficiency Article Snippet: TALEN, Cas9 and RAD51 mRNAs were transcribed in vitro , caped and polyadenylated using the Article Title: Host targeted inhibitors of dengue virus and other viruses Article Snippet: In vitro transcripts were synthesized from PstI linearized pDENrep-FH using Synthesized:Article Title: Methods, compositions, and kits for preparing nucleic acid libraries Article Snippet: Materials Target polynucleotide, human gDNA (BIO-35025) DNA fragmenting enzyme, KAPA Frag Kit (Roche, 7962517001) Adaptor template oligos (ATO), 1-019, 1-020 (Table 1) TAQ DNA polymerase (NEB, M0273L) TAQ DNA polymerase buffer (NEB, M0273L) DNA Polymerase I, Large (Klenow) Fragment (NEB, M0210L, M0212L) dNTPs (NEB, N0447s) USER® Enzyme (NEB, M5505S) Agencourt AMPure XP (Beckman Coulter, A63881) Article Title: Human-rabbit Hybrid Translation System to Explore the Function of Modified Ribosomes Article Snippet: Article Title: A specific eIF4A paralog facilitates LARP1-mediated translation repression during mTORC1 inhibition Article Snippet: Two guide RNAs were transcribed from the template PCR fragments (5′- TAATACGACTCACTATAGG GTGGCTCCGCGGATTATAAC GTTTAAGAGCTAT GCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGA AAAAGTGGCACCGAGTCGGTGCTTTTTTT-3′ and 5′- TAATACGACTCACTATAGG CCAGAGGGAATGGACCCCGA GTTTAAGAGCTA TGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTG AAAAAGTGGCACCGAGTCGGTGCTTTTTTT-3′, where the underlined characters represent sequences complementary to the EIF4A2 gene locus) by a Article Title: Sequence grammar and dynamics of subcellular translation revealed by APEX-Ribo-Seq Article Snippet: After hybridization of complementary DNA to the T7 promoter sequence, RNAs were amplified by in vitro transcription using the Article Title: Methods, compositions, and kits for preparing nucleic acid libraries Article Snippet: Materials Target polynucleotide, human gDNA (BIO-35025) DNA fragmenting enzyme, KAPA Frag Kit (Roche, 7962517001) Adaptor template oligos (ATO), 1-021 (Table 1) TAQ DNA polymerase (NEB, M0273L) TAQ DNA polymerase buffer (NEB, M0273L) DNA Polymerase I, Large (Klenow) Fragment (NEB, M0210L, M0212L) dNTPs (NEB, N0447s) Phusion® High-Fidelity DNA Polymerase (NEB, M0530S) Phusion buffer (NEB, M0530S) USER® Enzyme (NEB, M5505S) S1 Nuclease (ThermoFisher, EN0321) Agencourt AMPure XP (Beckman Coulter, A63881) Article Title: RS-1 enhances CRISPR/Cas9- and TALEN-mediated knock-in efficiency Article Snippet: TALEN, Cas9 and RAD51 mRNAs were transcribed in vitro , caped and polyadenylated using the Article Title: Host targeted inhibitors of dengue virus and other viruses Article Snippet: In vitro transcripts were synthesized from PstI linearized pDENrep-FH using |